View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1482_high_26 (Length: 235)
Name: NF1482_high_26
Description: NF1482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1482_high_26 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 235
Target Start/End: Original strand, 30654649 - 30654868
Alignment:
| Q |
16 |
gttattgtttttgcgacctatgtttgatttcctaacgtttctctgccgctctttctaaggttgtcgttgctttgtggtttgccggttcgtgggttccagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
30654649 |
gttattgtttttgcgacctatgtttgatttcttaacgtttctctgccgctctttctaaggttaccattgctttgtggtttgctggttcgtgggttccagt |
30654748 |
T |
|
| Q |
116 |
ccaagttcagatctgcgtgtttagatgctcgctccggtcgctagcttctgcttcggtaaagctcatgcacaatttaagtgggttcgtagaaagtcctcaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
30654749 |
ccaagttcagatctgcgtgtttagatgctcgcttcggccgctagcttctgcttcggtaaagctcatgcacggtttaagtgggttcatagaaagtcctcaa |
30654848 |
T |
|
| Q |
216 |
aaccactgtaggcatcgccg |
235 |
Q |
| |
|
||||| || |||||||||| |
|
|
| T |
30654849 |
aaccatagtcggcatcgccg |
30654868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University