View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1482_low_12 (Length: 368)
Name: NF1482_low_12
Description: NF1482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1482_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 3e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 160 - 352
Target Start/End: Original strand, 5496064 - 5496254
Alignment:
| Q |
160 |
cacgttagaatgtaataaatgaatgcaagttatatgcggacaaaataaactattagtgggaatgaaacgtggtgctgttgatagcatttcgtgtctcgtt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5496064 |
cacgttagaatgtaataaatgaatgcaagttatatgcggacaaaataaactattagtgggaatgaaacgtggtgctgttgatagcatttcgtgtctcgtt |
5496163 |
T |
 |
| Q |
260 |
ttcaaattgacctatttcatttaatttaaataaaatatataggtgtaagaatataaataaatgagggagatatggtggttatgtagaagcagt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5496164 |
ttcaaattgacctatttcatttaatttaaataaaatatataggtgtaagaatataaataaatgagggag--atggtggttatgtagaagcagt |
5496254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University