View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1482_low_32 (Length: 210)
Name: NF1482_low_32
Description: NF1482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1482_low_32 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 210
Target Start/End: Complemental strand, 39392617 - 39392423
Alignment:
| Q |
16 |
attctgcaacaatttttaagtgcacatgcatcatttcagccaatgaattcaaatgatgtgaagaaaccaatgcttgcaaattgcaatatttcacccaaca |
115 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39392617 |
attctgcaccaatttttaagttcacatgcatcatttcagccaatgaattcaaatgatgagaagaaaccaatgcttgcaaattgcaatatttcacccaaca |
39392518 |
T |
|
| Q |
116 |
cttttcaaaattcggttacaaattaagggttaagaacataagctataattgtataagccaaatgtagaggaaaataatactaaatttagacaatc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39392517 |
cttttcaaaattcggttacaaattaagggttaagaacataagctataattgtataagccaaatgtagaggaaaataatactaaatttagacaatc |
39392423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University