View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14830_high_2 (Length: 323)
Name: NF14830_high_2
Description: NF14830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14830_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 6e-37; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 6 - 116
Target Start/End: Original strand, 3379962 - 3380072
Alignment:
| Q |
6 |
cataggcagaagaatgatccagataaagatactagaaataactcaattgaccttaatttatagggcttcatctcatttgcaattgctagacaatgttgta |
105 |
Q |
| |
|
|||| |||||||||||||||||||||| | || || |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3379962 |
cataagcagaagaatgatccagataaacaaacaagccataactcaattgaccttaatttgtagggcttcatctcatttacaattgctagacaatgttgta |
3380061 |
T |
 |
| Q |
106 |
atgagattccc |
116 |
Q |
| |
|
||||||||||| |
|
|
| T |
3380062 |
atgagattccc |
3380072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 211 - 302
Target Start/End: Original strand, 3369538 - 3369630
Alignment:
| Q |
211 |
tttcaagtaatattggctat-aaatttgttatttcttgagttatgccaatcaacaattttataatgatttctaactattggcattgaagctac |
302 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||| ||||||| ||||| |||||| ||||||| |||||||||||| |||| ||||||| ||||| |
|
|
| T |
3369538 |
tttcaagttatattggctatgaaattatttagttcttgaattatgacaatcactaattttagaatgatttctaattattagcattgaggctac |
3369630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 211 - 302
Target Start/End: Original strand, 3395155 - 3395247
Alignment:
| Q |
211 |
tttcaagtaatattggctat-aaatttgttatttcttgagttatgccaatcaacaattttataatgatttctaactattggcattgaagctac |
302 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||| ||||||| ||||| |||||| ||||||| |||||||||||| |||| ||||||| ||||| |
|
|
| T |
3395155 |
tttcaagttatattggctatgaaattatttagttcttgaattatgacaatcactaattttagaatgatttctaattattagcattgaggctac |
3395247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University