View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14831_high_15 (Length: 248)
Name: NF14831_high_15
Description: NF14831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14831_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 138 - 231
Target Start/End: Original strand, 25151117 - 25151210
Alignment:
| Q |
138 |
ctaaaatagcatgcactcaccaagatctgatatgtttcaaaatgcannnnnnngttaattgatccaagcaaggtttgaatcaattcacaacatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25151117 |
ctaaaatagcatgcactcaccaagatctgatatgtttcaaaatgcatttttttgttaattgatccaagcaaggtttgaatcaattcacaacatt |
25151210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 10 - 84
Target Start/End: Original strand, 25150988 - 25151062
Alignment:
| Q |
10 |
ttatgattgaaatccatcacgtttaactcatgggaatgagagaaaatcaatgtgtgattatttgataatcaaaaa |
84 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25150988 |
ttatgattgaaatccatcacgtttaacttatgggaatgagagaaaatcaatgtgtgattatttgataatcaaaaa |
25151062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 230
Target Start/End: Complemental strand, 25168276 - 25168191
Alignment:
| Q |
145 |
agcatgcactcaccaagatctgatatgtttcaaaatgcannnnnnngttaattgatccaagcaaggtttgaatcaattcacaacat |
230 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||| ||||||| || ||| |||| | |||||||||||||||||| |
|
|
| T |
25168276 |
agcatgcactcaccaaaatctcatatgtttctaaatgcatttctttgttaattaattcaaacaagttgtgaatcaattcacaacat |
25168191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University