View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14831_low_23 (Length: 213)
Name: NF14831_low_23
Description: NF14831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14831_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 29015322 - 29015503
Alignment:
| Q |
14 |
aagaatatgtttggagtcactagattcaggaaatcatcaaatagtacaactccccgattttcctggcggagaagaagcatttgaactctgcgcaaaattc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29015322 |
aagattatgtttggagtcactagattcaggaaatcatcaaatagtacaactccccgattttcctggcggagaagaagcatttgaactctgcgcaaaattc |
29015421 |
T |
 |
| Q |
114 |
tgctatggaatcacaatcactctaagtgcttacaacattgtatccacaagatgtgccgcggaatatttacaaatgacagaag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29015422 |
tgctatggaatcacaatcactctaagtgcttacaacattgtatccacaagatgtgccgcggaatatttacaaatgacagaag |
29015503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 46 - 195
Target Start/End: Original strand, 14128867 - 14129016
Alignment:
| Q |
46 |
atcatcaaatagtacaactccccgattttcctggcggagaagaagcatttgaactctgcgcaaaattctgctatggaatcacaatcactctaagtgctta |
145 |
Q |
| |
|
|||| |||||||| ||||| || |||||||| || |||| ||||||||||| | || || || ||||||||||||||| ||| ||| ||||| |||| |
|
|
| T |
14128867 |
atcaccaaatagttcaacttcctgattttccgggtggagtggaagcatttgagttgtgtgctaagttctgctatggaatccaaattactttaagtcctta |
14128966 |
T |
 |
| Q |
146 |
caacattgtatccacaagatgtgccgcggaatatttacaaatgacagaag |
195 |
Q |
| |
|
|||||||||| | |||||||||| || |||||| | |||||||| |||| |
|
|
| T |
14128967 |
caacattgtagctgcaagatgtgctgctgaatatctccaaatgactgaag |
14129016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University