View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14832_high_6 (Length: 252)
Name: NF14832_high_6
Description: NF14832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14832_high_6 |
 |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0294 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 16369 - 16139
Alignment:
| Q |
1 |
cctggtgtcggacacgcgtttgtgtcagacataagaaagcttaaatagtagagttttttggtaacaaaatttagttaagttaggttcaagagcttcatgc |
100 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16369 |
cctggtgtcagacacgcgtttgtgtctgacataagaaagcttaaatagtagagttttttggtaacaaaatttagttaagttaggttcaagagcttcatgc |
16270 |
T |
 |
| Q |
101 |
gagtcataccaaatatcaagattcaaagagccttgacacttatatttagagtgatataccatccgttaaagaggttctagcagcggcggcagtaggagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16269 |
tagtcataccaaatatcaagattcaaa-agccttgacacttatatttagagtgatatatcatccgttaaagaggttctagcagcggcggcagtaggagtt |
16171 |
T |
 |
| Q |
201 |
gaattcatacatttacacattgtttaggcaac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16170 |
gaattcatacatttacacattgtttaggcaac |
16139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University