View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14832_low_9 (Length: 224)
Name: NF14832_low_9
Description: NF14832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14832_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 4487659 - 4487870
Alignment:
| Q |
1 |
ctcttctaattttgaaatttctatgttatatttttgtgttgtgattgaatccttttattttctctatgccgattttctccaacaccaccaacgttgccta |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4487659 |
ctcttctaattttgaagtttctatgttatatttttgtgttgtgattgagtctttttattttctctatgccgattttctccaacaccaccaacgttgccta |
4487758 |
T |
|
| Q |
101 |
accccgcgttatacaggttgatggtgaggcacgcgggtagtgtgtgaagatacaaagctaggaagggagtggatat----gagggtggagccatgaggat |
196 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4487759 |
accccgcgttatacaggttgatggcgaggcgcgcgggtagtgtgtgaagatacaaagctaggaagggagtggatatgaacgagggtggagccatgaggat |
4487858 |
T |
|
| Q |
197 |
gtggccattgtg |
208 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4487859 |
gtggccattgtg |
4487870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University