View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14833_high_18 (Length: 345)
Name: NF14833_high_18
Description: NF14833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14833_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 48060979 - 48061311
Alignment:
| Q |
1 |
ttcctaattgttttgggattttgggtttggctggttttgaaattgatgaggaaattttgggtaaaaatgggtttttgctggttcaagcattggttgattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48060979 |
ttcctaattgttttgggattttgggtttggctggttttgaaattgatgaggaaattttgggtaaaaatgggtttttgctggttcaagcattggttgattc |
48061078 |
T |
 |
| Q |
101 |
tgaagggagatttttagatgtttcatctgggtggccaaattcaatgaaacctgaaacgattttgcatgagagtaagctttaccatggggttgtggaatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48061079 |
tgaagggagatttttagatgtttcatctgggtggccaaattcgatgaaacctgaaacgattttgcatgagagtaagctttaccatggggttgtggaatca |
48061178 |
T |
 |
| Q |
201 |
agggaattgttgcaagggccatcttataagctaagtgatggaagtttgattcctcagtatgttttgggagattcatgttttccacttttgccttggcttt |
300 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48061179 |
agggaattgttgcaaggaccatcttataagctaagtgatggaagtttgattcctcagtatgttttgggagattcatgttttccacttttgccttggcttt |
48061278 |
T |
 |
| Q |
301 |
taacaccttatagtagagggaatgaagaagatg |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48061279 |
taacaccttatagtagagggaatgaagaagatg |
48061311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University