View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14833_high_26 (Length: 254)
Name: NF14833_high_26
Description: NF14833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14833_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 237
Target Start/End: Original strand, 38506985 - 38507212
Alignment:
| Q |
10 |
ccaatggtttgttctttttctccaaagtctggaaggccctgaaggatttttacgggattggattgggtgcattgatcacgttggtttttgctggactagg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38506985 |
ccaatggtttgttctttttctccaaagtctggaaggcgctgaaggatttttacgggattggattgggtgcatggatcacgttggtttttgctggactagg |
38507084 |
T |
 |
| Q |
110 |
acaatttgcaattgtcgtgaaggataggtttgggaagaatgttaggtgtcctgtctttgaacctactatgaaatttttcattgacaagacatttgttcaa |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38507085 |
acagtttgcaattgtcgtgaaggataggtttgggaagaatgttaggtgtcctgtctttgaacctcctatgaaatttttcattgacaagacatttgttcaa |
38507184 |
T |
 |
| Q |
210 |
ccaaccttcaatgatgttctccctccct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38507185 |
ccaaccttcaatgatgttctccctccct |
38507212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University