View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14833_high_31 (Length: 212)
Name: NF14833_high_31
Description: NF14833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14833_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 2571536 - 2571353
Alignment:
| Q |
20 |
tgtctgactaggattgtactatgtatgtggggcccttgacacgtaagcttacatgtttagatatacaccgttgaattga-ggtgtaattgtgattgatta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2571536 |
tgtctgactaggattgtactatgtatgtggggcccttgacacgtaagcttacatgtttagatatacaccgttgaattgaaggtgtaattgtgattgatta |
2571437 |
T |
|
| Q |
119 |
ttttgtttttcctaagttagcctaattagtatctttgtcgcctaatgcagctctacgatggtattcttaaagcttcttctctct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
2571436 |
ttttgtttttcctaagttagcctaattagtatctttgtcgcctaatgcagctctacggtggtattcttaaagctacttttctct |
2571353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University