View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14833_low_23 (Length: 297)
Name: NF14833_low_23
Description: NF14833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14833_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 31243720 - 31243443
Alignment:
| Q |
1 |
tggttcgttgttttgcacccaccgatgcaaatgatgggaccaacaatatggacattgatgctgatggtgagagggatggcttacttggggaaggatttca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31243720 |
tggttcgttgttatgcacccaccgatacaaatgatgggaccaacaatatggacattgatgctgatggtgagagggatggcttacttggggaaggattttc |
31243621 |
T |
 |
| Q |
101 |
agattttgaaccaatgcagctctgccatccaatacatgcttccattaatcctcactttttaagagaatttctaagcacaccggatctgcagtgcctagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31243620 |
agattttgaaccaatgcagctctgccatccactacatgcttccattaatcctcactttttaagagaatttctaagcacaccggatctgcagtgcctagtt |
31243521 |
T |
 |
| Q |
201 |
ttgaatcctgatgtgatgtggagtattttaaccaacagtcaagagctgtcgaacatagtttttgatcctagcagtgtg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31243520 |
ttgaatcctgatgtgatgtggagtattttaaccaacagtcaagagctgtcgggcatagtttttgatcctagcagtgtg |
31243443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 77 - 131
Target Start/End: Complemental strand, 7206843 - 7206789
Alignment:
| Q |
77 |
tggcttacttggggaaggatttcaagattttgaaccaatgcagctctgccatcca |
131 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||| |
|
|
| T |
7206843 |
tggcttagttggggaaggatttccagattttgaaccaatgcagcgctgtcatcca |
7206789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 278
Target Start/End: Complemental strand, 7206739 - 7206699
Alignment:
| Q |
238 |
gtcaagagctgtcgaacatagtttttgatcctagcagtgtg |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
7206739 |
gtcaagagctgtcgagcatagtttttgatcctaacagtgtg |
7206699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University