View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14833_low_31 (Length: 220)
Name: NF14833_low_31
Description: NF14833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14833_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 108 - 185
Target Start/End: Complemental strand, 5680292 - 5680215
Alignment:
| Q |
108 |
cctgattattattggtgcatgacaccaatggaagaaggaggaggaggaggaagagacatgttgtggaaatgatgatgt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680292 |
cctgattattattggtgcatgacaccaatggaagaaggagcaggaggaggaagagacatgttgtggaaatgatgatgt |
5680215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 5689642 - 5689598
Alignment:
| Q |
108 |
cctgattattattggtgcatgacaccaatggaagaaggaggagga |
152 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
5689642 |
cctgattatttttggtgcatgagaccaatggaagaaggagaagga |
5689598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University