View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14833_low_34 (Length: 209)
Name: NF14833_low_34
Description: NF14833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14833_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 9 - 126
Target Start/End: Original strand, 41405634 - 41405751
Alignment:
| Q |
9 |
gagaagaaggggtcgtcggtgatgtgaagtcttggtcgtgatgaatggattgaagggactgcggggatggtgaggatgatggcagtagtggttagcgatg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
41405634 |
gagaagaaggggtcgtcggtgatgtgaagtcttggtcgtgatgaatggaatgaagggactgcggggatggtgagtacgatggcagtagtggttagcgatg |
41405733 |
T |
|
| Q |
109 |
aggacggtggtgggggag |
126 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41405734 |
aggacggtggtgggggag |
41405751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 42
Target Start/End: Original strand, 51680223 - 51680256
Alignment:
| Q |
9 |
gagaagaaggggtcgtcggtgatgtgaagtcttg |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51680223 |
gagaagaaggggtcgtcggtgatgtgaagtcttg |
51680256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 126
Target Start/End: Complemental strand, 24763830 - 24763778
Alignment:
| Q |
74 |
gatggtgaggatgatggcagtagtggttagcgatgaggacggtggtgggggag |
126 |
Q |
| |
|
||||||||||| ||| | || |||||||||||||||||| ||||||||||||| |
|
|
| T |
24763830 |
gatggtgaggacgattgaagcagtggttagcgatgaggatggtggtgggggag |
24763778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 141
Target Start/End: Original strand, 41405764 - 41405795
Alignment:
| Q |
110 |
ggacggtggtgggggagcggacgagagagaaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41405764 |
ggacggtggtgggggagcggacgagagagaaa |
41405795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 40 - 126
Target Start/End: Complemental strand, 48071944 - 48071858
Alignment:
| Q |
40 |
ttggtcgtgatgaatggattgaagggactgcggggatggtgaggatgatggcagtagtggttagcgatgaggacggtggtgggggag |
126 |
Q |
| |
|
||||||||| |||| | |||||||||| | | ||||| ||||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
48071944 |
ttggtcgtggtgaaagaattgaagggatggagatgatggcgaggatgatggtagtagtggtaactgatgaggacggtggtgggggag |
48071858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 126
Target Start/End: Complemental strand, 4093094 - 4093042
Alignment:
| Q |
74 |
gatggtgaggatgatggcagtagtggttagcgatgaggacggtggtgggggag |
126 |
Q |
| |
|
||||||||| | ||||||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
4093094 |
gatggtgagaacgatggcagtagaggttatcgacgaggacggtggtgggggag |
4093042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 40 - 123
Target Start/End: Complemental strand, 44001673 - 44001590
Alignment:
| Q |
40 |
ttggtcgtgatgaatggattgaagggactgcggggatggtgaggatgatggcagtagtggttagcgatgaggacggtggtgggg |
123 |
Q |
| |
|
||||||||| |||| | ||||||||||| | ||||| ||||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
44001673 |
ttggtcgtggtgaaagaattgaagggacgaagatgatggcgaggatgatggtagtagtggtaattgatgaggacggtggtgggg |
44001590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University