View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14834_low_11 (Length: 224)
Name: NF14834_low_11
Description: NF14834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14834_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 113 - 205
Target Start/End: Original strand, 527249 - 527342
Alignment:
| Q |
113 |
ttgctccatattttttgaacttggtttt-gtcatcagtttcttcaagcagtgtcctaatcctaatgatgctcagagaagagagctgagccttcg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
527249 |
ttgctccatattttttgaacttggtttttgtcatcagcttcttcaagcagtgtcctaatcctaatgatgctcagagaagagagctgagccttcg |
527342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 54
Target Start/End: Original strand, 527149 - 527188
Alignment:
| Q |
15 |
cacagagcaacaaattgatgaaatggatacgtaggaacca |
54 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
527149 |
cacacagcaacaaattgatgaaatggatacgtaggaacca |
527188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University