View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14834_low_4 (Length: 374)
Name: NF14834_low_4
Description: NF14834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14834_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 24 - 362
Target Start/End: Original strand, 25968848 - 25969187
Alignment:
| Q |
24 |
actagatgtagggaccactgctacgtggggtgacgtggtttgctatgggatatttttgtctccttttatcttttcacgaaaacttg-ttctttgtcttgc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||| || |||||||||| |
|
|
| T |
25968848 |
actagatgtagggaccactgctacgtggggtgacgtggtttgctatgggatttttttgtctcc--ttattttttcacgaaaacttgtttttttgtcttgc |
25968945 |
T |
|
| Q |
123 |
ttcattgtttattattannnnnnnataaagaaagtttcaagggttttcttgatcgtgcacgttcagaaggattatgatga-taacttattatatatttaa |
221 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| | | ||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25968946 |
ttcattgtttactattatttttttataaagaaagttttaggagttttcttgatcgtgcatattcagaaggattatgatgacctacttattatatatttag |
25969045 |
T |
|
| Q |
222 |
gaatcaaaatgactattatctttaaagatttaagaattgaattctaaag-ctcatcgaggctagggtttataaaatgttattaaagttatagtttaattt |
320 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
25969046 |
gaattaaaatgactattacctttaaagatttaagaattgaattctgaagattcatcgaggctagggtttataaaatgttatcgtagttatggtttaattt |
25969145 |
T |
|
| Q |
321 |
tttcgttattt-gtgctttttggttgaagaatttatatgacat |
362 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
25969146 |
ctt-gttatttagtgctttttggttgaagaatttataagacat |
25969187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University