View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14834_low_8 (Length: 248)
Name: NF14834_low_8
Description: NF14834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14834_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 30 - 244
Target Start/End: Original strand, 39501996 - 39502210
Alignment:
| Q |
30 |
gaaaagtgactattgatgattgaggcagtgatgcaaatgcaaacgcataccctgtcgtcaaattcgcctcgaagactgtctcaagagaggaacttgatta |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39501996 |
gaaaagtgactattgatgattgaggcagtgatgcaaatgcaaacgcataccctgtcgtcaaattcccctcgaagactgtctcaagagaggaacttgatta |
39502095 |
T |
 |
| Q |
130 |
tcgaagaagagttggaggtacctgccatggctttttgttatcatctagcacaagtattatggttttaaactacggtcgctgaaattgcacttacatgtac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39502096 |
tcgaagaagagttggaggtacctgccatggctttttgttatcatctaacacaagtattatggttttaaactacggtcgctgaaattgcacttacatgtac |
39502195 |
T |
 |
| Q |
230 |
ttcaacatccttcat |
244 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39502196 |
ttcaacatccttcat |
39502210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University