View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14835_high_17 (Length: 206)
Name: NF14835_high_17
Description: NF14835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14835_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 23 - 188
Target Start/End: Complemental strand, 33223781 - 33223616
Alignment:
| Q |
23 |
aagagaggagttgaaaagtctggtgcagtgacagtagcacactattatgctacttgtagagattgnnnnnnnnataatgatgccgggattttttcnnnnn |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
33223781 |
aagagaggagttgaaaagtctggtgcagtgacagtagcacactattatgctacttgtacagattgttttttttataatgatgccgggattttttcaaaaa |
33223682 |
T |
|
| Q |
123 |
nnngttgatgtctggctttcaacggaagtagttattactgtgttaaacaataatggtttggatgtt |
188 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33223681 |
aaagttgatgtcgggctttcaacggaagtagttattactgtattaaacaataatggtttggatgtt |
33223616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 33226720 - 33226664
Alignment:
| Q |
18 |
agagaaagagaggagttgaaaagtctggtgcagtgacagtagcacactattatgcta |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33226720 |
agagaaagagaggagttgaaaagtctggtgcagtgagagtagcacactattatgcta |
33226664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 146 - 181
Target Start/End: Complemental strand, 33226593 - 33226558
Alignment:
| Q |
146 |
ggaagtagttattactgtgttaaacaataatggttt |
181 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33226593 |
ggaagtagttattactgtggtaaacaataatggttt |
33226558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University