View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14835_high_4 (Length: 364)
Name: NF14835_high_4
Description: NF14835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14835_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 37 - 176
Target Start/End: Original strand, 43221655 - 43221794
Alignment:
| Q |
37 |
atgagactctcaaagccaacactgattctctttgtctttttcatcttcactgtaacgtgtgttgttcaaatggaagcagtgatcaacgaacgagttgttg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43221655 |
atgagactctcaaagccaacactgattctctttgtctttttcatcttcactgtaacgtgtgttgttcaaatggaagcagtgatcaacgaacgagttgttg |
43221754 |
T |
 |
| Q |
137 |
atgctggctctggaagtagttctgtcaatgttgttgtgag |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43221755 |
atgctggctctggaagtagttctgtcaatgttgttgtgag |
43221794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 244 - 349
Target Start/End: Original strand, 43221862 - 43221967
Alignment:
| Q |
244 |
tttctgcttgtgccctatttaggttagcagctcaattattttttagagtaactggttattttactatgcagagaagaggtgaatgtgaaaaacaaggcgt |
343 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43221862 |
tttctgcctgtgccctatttaggttagcagctcaattattttttagagtaactggttattttactatgcagagaagaggtgaatgtgaaaaacaaggcgt |
43221961 |
T |
 |
| Q |
344 |
tgagtg |
349 |
Q |
| |
|
|||||| |
|
|
| T |
43221962 |
tgagtg |
43221967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University