View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14835_low_16 (Length: 255)
Name: NF14835_low_16
Description: NF14835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14835_low_16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 34578418 - 34578181
Alignment:
| Q |
18 |
ggtgatatagaagataattggaagaggtgagaaaatagtaaatgcatatgacatttcaaattcataccttttacaatgtctcttttaacaacataacata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34578418 |
ggtgatatagaagataattggaagaggtgagaaaatagtaaatgtatatgacatttcaaattcataccttttacaatgtctcttttaacaacataacata |
34578319 |
T |
|
| Q |
118 |
attgaggttaataaagtataagacctcaactcctcaagaattccattcctatttatatatttcaatgtttaattgtttttcttcattttctatgttgtga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34578318 |
attgaggttaataaagtataagacctcaactcctcaagaattcctttcctatttatatatttcaatgtttaattgtttttcttcattttctatgttgtga |
34578219 |
T |
|
| Q |
218 |
tcaactgactttattctacctcagcatgacttctatta |
255 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34578218 |
tcaactgactttattctacttcagcatgacttctatta |
34578181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University