View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14836_high_25 (Length: 239)
Name: NF14836_high_25
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14836_high_25 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 38155323 - 38155544
Alignment:
| Q |
19 |
atataggtacctccaagaaactgctatgaaagaaacgagggctttccttgctcataataggttggtgaacccattcttcataagcttcaccaagataacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38155323 |
atataggtacctccaagaaactgctatgaaagaaacgagggctttccttgctcataataggttggtgaacccattcttcataagcttcaccaagataacc |
38155422 |
T |
 |
| Q |
119 |
aacctgtcacatattgttgtaaaattaaattgtgatggtgcagtgatt-aaaaaagttgaggataaataaaaatgtaataatttgagtttacttggaaaa |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38155423 |
aacctgtcacatagtgttgtaaaattaaattgtgatggtgcagtgattaaaaaaagttgaggataaataaaaatgtaataatttgagtttacttggaaaa |
38155522 |
T |
 |
| Q |
218 |
caaggggcttattcaaatcaac |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38155523 |
caaggggcttattcaaatcaac |
38155544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 22 - 138
Target Start/End: Original strand, 38164218 - 38164334
Alignment:
| Q |
22 |
taggtacctccaagaaactgctatgaaagaaacgagggctttccttgctcataataggttggtgaacccattcttcataagcttcaccaagataaccaac |
121 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |||||||| |||||||||||| |||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
38164218 |
taggtacctccaagatattgctatgaaagaaacgagggccttccttgcccataataggttgatgaacccatttatcataatcttcaccaagatgaccaac |
38164317 |
T |
 |
| Q |
122 |
ctgtcacatattgttgt |
138 |
Q |
| |
|
|||||| ||| |||||| |
|
|
| T |
38164318 |
ctgtcatatagtgttgt |
38164334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 123
Target Start/End: Complemental strand, 11770701 - 11770623
Alignment:
| Q |
45 |
tgaaagaaacgagggctttccttgctcataataggttggtgaacccattcttcataagcttcaccaagataaccaacct |
123 |
Q |
| |
|
||||||||||| || | ||||||||| | ||| || || |||||||| ||||||||||| |||||||||| ||||||| |
|
|
| T |
11770701 |
tgaaagaaacggggaccttccttgctaacaatgggctgatgaacccactcttcataagcctcaccaagatgtccaacct |
11770623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University