View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14836_high_29 (Length: 226)
Name: NF14836_high_29
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14836_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 219
Target Start/End: Complemental strand, 6636624 - 6636411
Alignment:
| Q |
6 |
tttctaattttagtatattatttggcttgaagattcatgcacctccttgcttttcttatcaagtggcactgcatgaaattatgaatcctcctccatggtg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6636624 |
tttctaattttagtatattatttggcttgaagattcatgcacctccttgcttttcttatcaagtggcactgcatgaaattatgaatcctcctccatggtg |
6636525 |
T |
|
| Q |
106 |
gattcgatgcaatctgaccagaaaatatgttatgccataaaaacaaggtttatgtatgattttgatacctgcatgcaggctgcaaatatttcacttttta |
205 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6636524 |
gattagatgcaatctgacaagaaaatatgttatgccataacaacaaggtttatgtatgattttgatacctgcatgcaggctgcaaatatttcacttttta |
6636425 |
T |
|
| Q |
206 |
tttttggtcctttg |
219 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
6636424 |
tttttggtcttttg |
6636411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University