View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14836_high_30 (Length: 224)
Name: NF14836_high_30
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14836_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 11990121 - 11990183
Alignment:
| Q |
20 |
tctttaatttcaactccgctaatcccagcattgttaacctacacaatatgtacaaattaaaca |
82 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11990121 |
tctttaatttcaactccgccaatccctgcattgttaacctacacaatatgtacaaattaaaca |
11990183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 11991260 - 11991313
Alignment:
| Q |
123 |
ctcctatcctacacctcaacctcatgttatcttgttttcattttctgtggaccc |
176 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11991260 |
ctcctatcttatccctcaacctcatgttatcttgttttcattttttgtggaccc |
11991313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 12003993 - 12004042
Alignment:
| Q |
18 |
tgtctttaatttcaactccgctaatcccagcattgttaacctacacaata |
67 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
12003993 |
tgtctttaatttcaattccgttaatcccagcattgttaacctacaaaata |
12004042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 11997688 - 11997731
Alignment:
| Q |
19 |
gtctttaatttcaactccgctaatcccagcattgttaacctaca |
62 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
11997688 |
gtctttaacttcaaccccgctaatcccagcattgttaacctaca |
11997731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 12009526 - 12009571
Alignment:
| Q |
18 |
tgtctttaatttcaactccgctaatcccagcattgttaacctacac |
63 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12009526 |
tgtcgttaacttcaactccgctaatcccggcattgttaacctacac |
12009571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University