View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14836_high_34 (Length: 215)
Name: NF14836_high_34
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14836_high_34 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 2 - 215
Target Start/End: Original strand, 40411632 - 40411845
Alignment:
| Q |
2 |
attttgtcattattatgttgtataacatcgtcacgtaattaacatgatcgatgcaatatttgttacttgaccagaaactctaattgagcttcctctttaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40411632 |
attttgtcattattatgttgtataacatcgtcacgtaattaacatgatcgatgcaatatttgttacttgaccagaaactctaattgagcttcctctttaa |
40411731 |
T |
 |
| Q |
102 |
aaaatggtccatactttagagtggagacaactgttacaaacatgccttaatgaacttgacttgcataatttgccactcacaccaattatgtcggcaaatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40411732 |
aaaatggtccatactttagagtggagacaactgttacaaacatgccttaatgaacttgacttgcataatttgcaactcacaccaattatgtcggcaaatg |
40411831 |
T |
 |
| Q |
202 |
caaagcattcacgt |
215 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40411832 |
caaagcattcacgt |
40411845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University