View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14836_low_10 (Length: 415)
Name: NF14836_low_10
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14836_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 2e-68; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 26649581 - 26649724
Alignment:
| Q |
17 |
aggttaagcctttattgatgttatactgttgcttgccaagggtactagaaacaccatttttaaagcctatttaccaagggtgctagatgcattaggtaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26649581 |
aggttaagcctttattgatgttatactgttgcttgccaatggtactagaaacaccatttttaaagcctatttgccaagggtgctagatgcattaggtaaa |
26649680 |
T |
|
| Q |
117 |
tgtaattctcccaacatgaccttgacacaaaacactgagtgtga |
160 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26649681 |
tgtgattctcccaacatgaccttgacacaaaacactgagtgtga |
26649724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 263 - 379
Target Start/End: Original strand, 26650930 - 26651046
Alignment:
| Q |
263 |
atgaaaaacttaaatgagtcactccttactgatcgaagggagtaatataagaagcagccttttctacttcatgtccattctgtgtagatttagagcatat |
362 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26650930 |
atgaaaaacttaaatgagtcatttcttactgatcgaagggagtaatataagaagtagccttttctacttcatgtccattctgtgtagatttagagcatat |
26651029 |
T |
|
| Q |
363 |
caattatgttctaattc |
379 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26651030 |
caattatgttctaattc |
26651046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 26650829 - 26650868
Alignment:
| Q |
162 |
aatttttagaagacttaataaagatattttagtaaaaaca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26650829 |
aatttttagaagacttaataaagatattttagtaaaaaca |
26650868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 43 - 79
Target Start/End: Original strand, 1723236 - 1723272
Alignment:
| Q |
43 |
tgttgcttgccaagggtactagaaacaccatttttaa |
79 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1723236 |
tgttgcttgccaagggtactagaggcaccatttttaa |
1723272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University