View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14836_low_17 (Length: 314)
Name: NF14836_low_17
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14836_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 68 - 285
Target Start/End: Complemental strand, 4570492 - 4570275
Alignment:
| Q |
68 |
cttgtttatgaagataatgaaggagacaagatgctagtaggggacgtgccgtggcagtaagtatcttatcaatgtgaatcttattctattcaatatttat |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570492 |
cttgtttatgaagataatgaaggagacaagatgctagtaggggacgtgccgtggcagtaagtatcttatcaatgtgaatcttattctattcaatatttat |
4570393 |
T |
|
| Q |
168 |
atactgtttatattctttgaatagtgtttcaatgccaatgcaaaattaacctttgttttttaaaactatagtatagtttcttgtgcttaacaattaatac |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4570392 |
atactgtttatattctttgaatagtgtttcaatgccaatgcaaaattaacctttgttttttaaaactatagtatagtttcttgtgcttaacaattactac |
4570293 |
T |
|
| Q |
268 |
tatatataactcttgtaa |
285 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4570292 |
tatatataactcttgtaa |
4570275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University