View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14836_low_36 (Length: 229)
Name: NF14836_low_36
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14836_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 10768305 - 10768267
Alignment:
| Q |
163 |
tggttatgttagtttctagggttcgaaccctagacctcc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10768305 |
tggttatgttagtttctagggttcgaaccctaaacctcc |
10768267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 33911803 - 33911840
Alignment:
| Q |
20 |
aaagtttacattgaaaagtgaatatgacattcattttg |
57 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
33911803 |
aaagtttgcattgaaaagtgaacatgacattcattttg |
33911840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University