View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14836_low_6 (Length: 452)

Name: NF14836_low_6
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14836_low_6
NF14836_low_6
[»] chr3 (1 HSPs)
chr3 (1-161)||(24921717-24921873)
[»] chr1 (1 HSPs)
chr1 (14-236)||(2576650-2576871)
[»] chr4 (1 HSPs)
chr4 (54-107)||(53317823-53317876)


Alignment Details
Target: chr3 (Bit Score: 103; Significance: 4e-51; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 24921873 - 24921717
Alignment:
1 tatgttgatcaaatgaggtgaggcctagaaaggttaggagggttttttggttaatttggcacgccgcaatttggatcatttggatagagcggaatgattg 100  Q
    ||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||  ||| ||||||||||    
24921873 tatgttggtcaaatgaggtgaggcctaaaaaggttaggagggctttttggttaatttggcacgccgcaattcggatcatttggacggagaggaatgattg 24921774  T
101 tattttttaataattcgatcaaggaggttgataacttagtggagaagataaaagtcctatt 161  Q
    ||| |||||||||||||||||||||||||||| |||   ||| ||||||||||||||||||    
24921773 tat-ttttaataattcgatcaaggaggttgatgact---tggtgaagataaaagtcctatt 24921717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 2576871 - 2576650
Alignment:
14 tgaggtgaggcctagaaaggttaggagggttttttggttaatttggcacgccgcaatttggatcatttggatagagcggaatgattgtatttttta--at 111  Q
    |||| ||||||||| |||| ||||| | | ||  |||||||||||| |||| ||||||| | | ||||||| ||||  |||||||| ||| ||| |  ||    
2576871 tgagttgaggcctataaagcttaggcgtggttagtggttaatttggtacgcggcaatttaggtgatttggaaagagatgaatgattatatctttaatgat 2576772  T
112 aattcgatcaaggaggttgataacttagtggagaagataaaagtcctattgtggcattggagtcttagtaggttgaaaattgtg-catgtttgtactact 210  Q
    |||  || ||||||||||||  | || ||||| || ||||| ||| | ||||||||||||||||||| |||||||||||||||| |  ||||||| |||     
2576771 aat--ga-caaggaggttgacgaattggtggaaaaaataaa-gtcttcttgtggcattggagtcttactaggttgaaaattgtgtcgcgtttgtattacg 2576676  T
211 agtggtgttggaatcctagggattgt 236  Q
     || || ||||||||||| |||||||    
2576675 cgtagtattggaatcctatggattgt 2576650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 54 - 107
Target Start/End: Complemental strand, 53317876 - 53317823
Alignment:
54 atttggcacgccgcaatttggatcatttggatagagcggaatgattgtattttt 107  Q
    ||||||||||||| ||||||| | ||||||| ||||||||||||| | ||||||    
53317876 atttggcacgccgtaatttgggtgatttggaaagagcggaatgataggattttt 53317823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University