View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14836_low_9 (Length: 417)
Name: NF14836_low_9
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14836_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 36 - 403
Target Start/End: Complemental strand, 2783659 - 2783297
Alignment:
| Q |
36 |
taaacatcaatggcgaagctattatccttagcttgctttcgaaacgaaggatggcacaatctttcagctagatctcactacccttccatgccttcttttc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783659 |
taaacatcaatggcgaagctattatccttagcttgctttcgaaacgaaggatggcacaatctttcagctagatctcactacccttccatgccttcttttc |
2783560 |
T |
 |
| Q |
136 |
ccaaaagcgagccaggtacctccaccgtggaggagccgtccaaagtcaccgcacttttctcggtccatggtatgacttgctccgcttgcgctggatctgt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783559 |
ccaaaagcgagccaggtacctccaccgtggaggagccgtccaaagtcaccgcacttttctcggtccatggtatgacttgctccgcttgcgctggatctgt |
2783460 |
T |
 |
| Q |
236 |
ggagaaatccatcaaacggctacatggaattcatgaagctgttgttgatgtacttcataaccgtgcccgcgtcatctttcacccctcttttgttaacgta |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783459 |
ggagaaatccatcaaacggctacatggaattcatgaagctgttgttgatgtacttcataaccgtgcccgcgtcatctttcacccctcttttgttaacgta |
2783360 |
T |
 |
| Q |
336 |
cgtaactcacccctcttttattcattttgtgtgatttactgagattcagtctttgtcgtttttcatct |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
2783359 |
cgtaactcacccctcttttattcattttgtgtggtttactgaga-----tctttgtcgtttttcatct |
2783297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University