View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14838_high_4 (Length: 208)
Name: NF14838_high_4
Description: NF14838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14838_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 38233310 - 38233130
Alignment:
| Q |
12 |
tgagaagaacgtccgatgcccacttaactgtgtcgtatgcaatgctaactatgaggataacaaccacatattcagggacaaatttctttggagacccccc |
111 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
38233310 |
tgagtagaacgtctgatgcccacttaactgtgtcgtatgcaatgctaactatgaggataacaaccacatattcagggacaaatctctttggagac-cccc |
38233212 |
T |
 |
| Q |
112 |
aggtgtcactgcactcccagtttaaatataaatttcatattatacatgatacttcaactgatacgttctcgctgtggcggtt |
193 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
38233211 |
aggtgccactgcactcccagtttaaatataaatttcatattatacatgatacttcaactgatacgttctcgttgtagcggtt |
38233130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 96 - 185
Target Start/End: Complemental strand, 15234971 - 15234882
Alignment:
| Q |
96 |
tctttggagaccccccaggtgtcactgcactccca-gtttaaatataaatttcatattatacatgatacttcaactgatacgttctcgctg |
185 |
Q |
| |
|
||||||||||||||| ||||| | |||||| |||| |||| |||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
15234971 |
tctttggagaccccc-aggtgcctctgcacccccaagtttttatataaatttcatattatacatgatatttcaactgatacgttgtcgctg |
15234882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 155
Target Start/End: Original strand, 26942266 - 26942325
Alignment:
| Q |
96 |
tctttggagaccccccaggtgtcactgcac-tcccagtttaaatataaatttcatattata |
155 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
26942266 |
tctttggagaccccc-aggtgccactgcacctcccagtttgcatataaatttcatattata |
26942325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 154
Target Start/End: Original strand, 44945016 - 44945073
Alignment:
| Q |
96 |
tctttggagaccccccaggtgtcactgcactcccagtttaaatataaatttcatattat |
154 |
Q |
| |
|
||||||||||||||| ||||| |||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
44945016 |
tctttggagaccccc-aggtgccactccacccccagtttttatataaatttcatattat |
44945073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 44970095 - 44970157
Alignment:
| Q |
109 |
cccaggtgtcactgcactccc-agtttaaatataaatttcatattatacatgatacttcaact |
170 |
Q |
| |
|
|||||||| |||||||| ||| |||||| |||||||||||||||||| ||||| | ||||||| |
|
|
| T |
44970095 |
cccaggtgccactgcaccccccagtttatatataaatttcatattatgcatgacatttcaact |
44970157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 5e-18; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 96 - 185
Target Start/End: Original strand, 17549162 - 17549251
Alignment:
| Q |
96 |
tctttggagaccccccaggtgtcactgcactccca-gtttaaatataaatttcatattatacatgatacttcaactgatacgttctcgctg |
185 |
Q |
| |
|
||||||||||||||| ||||| | |||||| |||| |||| |||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
17549162 |
tctttggagaccccc-aggtgcctctgcacccccaagtttttatataaatttcatattatacatgatatttcaactgatacgttgtcgctg |
17549251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 96 - 154
Target Start/End: Complemental strand, 31736957 - 31736900
Alignment:
| Q |
96 |
tctttggagaccccccaggtgtcactgcactcccagtttaaatataaatttcatattat |
154 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
31736957 |
tctttggagaccccc-aggtgccactgcacccccagtttttatataaatttcatattat |
31736900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 185
Target Start/End: Complemental strand, 37101840 - 37101792
Alignment:
| Q |
137 |
atataaatttcatattatacatgatacttcaactgatacgttctcgctg |
185 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | ||||||| |||||| |
|
|
| T |
37101840 |
atataaatttcatattatacatgataattcaattaatacgttatcgctg |
37101792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 112 - 159
Target Start/End: Original strand, 26229227 - 26229274
Alignment:
| Q |
112 |
aggtgtcactgcactcccagtttaaatataaatttcatattatacatg |
159 |
Q |
| |
|
||||| |||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
26229227 |
aggtgccactgcacccccagtttatatataaatttcatattatgcatg |
26229274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University