View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14838_low_2 (Length: 375)
Name: NF14838_low_2
Description: NF14838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14838_low_2 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0097 (1 HSPs) |
 |  |  |
|
| [»] scaffold0648 (1 HSPs) |
 |  |  |
|
| [»] scaffold0274 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 12)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 75 - 300
Target Start/End: Complemental strand, 900200 - 899975
Alignment:
| Q |
75 |
agacttataagtgccatcccttagatcatacacaatcaacttattttcccaatctcgatactcaatattcaagcaacacttgaccatccttaaacatatg |
174 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
900200 |
agacttataagtgtcatcccttagatcataaacaatcaatttattttcccaatctcgatactcaatattcaagcaacacttgaccatccttaaacatatg |
900101 |
T |
 |
| Q |
175 |
taatgcattggtcaaggtgcaagacttttaagaaacggtgaacaatttaatcgaagactctttgtttcaatattcattcatataacccaaacatcatgac |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
900100 |
taatgcattggtcaaggtgcaagacttttaagaaacggtgaacaatttaatcgaagactctttgtttcaatattcattcatataacccaaacatcatgac |
900001 |
T |
 |
| Q |
275 |
aagaaatcatgcacaagcattccctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
900000 |
aagaaatcatgcacaagcattccctc |
899975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 300 - 362
Target Start/End: Original strand, 25644576 - 25644638
Alignment:
| Q |
300 |
ccaggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
25644576 |
ccaggggcagatctctttggagaccctcagatgccattgcaccccccagttttaatataaatt |
25644638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 212 - 300
Target Start/End: Original strand, 803214 - 803300
Alignment:
| Q |
212 |
gtgaacaatttaatcgaagactctttgtttcaatattcattcatataacccaaacatcatgacaagaaatcatgcacaagcattccctc |
300 |
Q |
| |
|
|||||||| ||| || |||||||||| |||| |||||| |||||| ||||||||||||| || |||||||||||||||||| |||||| |
|
|
| T |
803214 |
gtgaacaacttagtccaagactctttatttccatattctttcata--acccaaacatcatcaccagaaatcatgcacaagcaatccctc |
803300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 302 - 362
Target Start/End: Complemental strand, 42641995 - 42641935
Alignment:
| Q |
302 |
aggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||| || ||| ||||||||| |
|
|
| T |
42641995 |
aggggcggatctctttggagacccccaggtgccactgcacccccgaggttttatataaatt |
42641935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 347
Target Start/End: Original strand, 8541097 - 8541143
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcacccccca |
347 |
Q |
| |
|
||||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
8541097 |
caggggcggatctctttagagacccccaggtgccactgcacccccca |
8541143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 212 - 300
Target Start/End: Original strand, 2686308 - 2686397
Alignment:
| Q |
212 |
gtgaacaatttaatcgaagactctttgtttcaatattcattcat-ataacccaaacatcatgacaagaaatcatgcacaagcattccctc |
300 |
Q |
| |
|
|||||||||||| || |||||||||| |||| |||||| ||||| |||||||||||||||| || | | |||| |||||| || |||||| |
|
|
| T |
2686308 |
gtgaacaatttattccaagactctttttttccatattccttcataataacccaaacatcatcaccacagatcaagcacaaacaatccctc |
2686397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 203 - 299
Target Start/End: Original strand, 2696719 - 2696813
Alignment:
| Q |
203 |
taagaaacggtgaacaatttaatcgaagactctttgtttcaatattcattcatataacccaaacatcatgacaagaaatcatgcacaagcattccct |
299 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||| |||| |||||| ||| |||| ||||||||||||| ||||||| || |||||| ||||| |
|
|
| T |
2696719 |
taagatacagtgaacaatttaatccaagactctttatttccatattccttc--ataatccaaacatcatgatcggaaatcaagcccaagcaatccct |
2696813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 345
Target Start/End: Original strand, 27813512 - 27813556
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccc |
345 |
Q |
| |
|
||||||||||||||||| |||||||| || ||||||||||||||| |
|
|
| T |
27813512 |
caggggcggatctctttagagacccccaggtgccactgcaccccc |
27813556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 345
Target Start/End: Complemental strand, 47278408 - 47278364
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccc |
345 |
Q |
| |
|
||||||||||||||||| |||||||| || ||||||||||||||| |
|
|
| T |
47278408 |
caggggcggatctctttagagacccccaggtgccactgcaccccc |
47278364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 203 - 293
Target Start/End: Complemental strand, 2459339 - 2459251
Alignment:
| Q |
203 |
taagaaacggtgaacaatttaatcgaagactctttgtttcaatattcattcatataacccaaacatcatgacaagaaatcatgcacaagca |
293 |
Q |
| |
|
||||||||||| |||||||| || |||||||||| |||| |||||| ||| |||| ||||||| |||||| |||||| ||| ||||||| |
|
|
| T |
2459339 |
taagaaacggtaaacaattttgtccaagactctttatttccatattccttc--ataatccaaacaacatgaccagaaattatggacaagca |
2459251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 300
Target Start/End: Complemental strand, 3754652 - 3754569
Alignment:
| Q |
215 |
aacaatttaatcgaagactctttgtttcaatattcattcatataacccaaacatcatgacaagaaatcatgcacaagcattccctc |
300 |
Q |
| |
|
||||||||| || |||||||||| |||| |||||| |||||| |||||||||||| || |||| ||| ||||||||| |||||| |
|
|
| T |
3754652 |
aacaatttagtccaagactctttatttccatattccttcata--acccaaacatcaacaccagaagtcacgcacaagcaatccctc |
3754569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 310 - 362
Target Start/End: Complemental strand, 38233229 - 38233178
Alignment:
| Q |
310 |
atctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
||||||||||||||||| || |||||||||| | |||||||| |||||||||| |
|
|
| T |
38233229 |
atctctttggagacccccaggtgccactgca-ctcccagtttaaatataaatt |
38233178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 300 - 362
Target Start/End: Original strand, 181480 - 181542
Alignment:
| Q |
300 |
ccaggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
181480 |
ccaggggcggatctctttggagacccccagatgccactgcaccccctagttttaatataaatt |
181542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 10)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 300 - 362
Target Start/End: Complemental strand, 1076141 - 1076079
Alignment:
| Q |
300 |
ccaggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1076141 |
ccaggggcggatctctttggagacccccagatgccactgcaccccccagtttttatataaatt |
1076079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 362
Target Start/End: Complemental strand, 15234983 - 15234922
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||||||||||||||||||||| || |||| |||||||||| |||||| ||||||||| |
|
|
| T |
15234983 |
caggggcggatctctttggagacccccaggtgcctctgcacccccaagtttttatataaatt |
15234922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 301 - 362
Target Start/End: Original strand, 36723894 - 36723956
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccac-tgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | | |||||||||||| ||||||||| |
|
|
| T |
36723894 |
caggggcggatctctttggagacccccagatgccacttcccccccccagtttttatataaatt |
36723956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 301 - 362
Target Start/End: Original strand, 44945004 - 44945064
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| || ||||||||||| ||||||||| |
|
|
| T |
44945004 |
caggggcggatctctttggagacccccaggtgccactcca-cccccagtttttatataaatt |
44945064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 299 - 362
Target Start/End: Original strand, 44970069 - 44970132
Alignment:
| Q |
299 |
tccaggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||||||||||||| ||||| || || ||||||||||||||||||||| ||||||||| |
|
|
| T |
44970069 |
tccaggggcggatctcttcagagactcccaggtgccactgcaccccccagtttatatataaatt |
44970132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 309 - 362
Target Start/End: Original strand, 26942262 - 26942315
Alignment:
| Q |
309 |
gatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||| ||||||||| |
|
|
| T |
26942262 |
gatctctttggagacccccaggtgccactgcacctcccagtttgcatataaatt |
26942315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 301 - 346
Target Start/End: Complemental strand, 49017103 - 49017058
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcacccccc |
346 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
49017103 |
caggggcggatctctttagagacccccaggtgccactgcacccccc |
49017058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 361
Target Start/End: Complemental strand, 21809368 - 21809309
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaat |
361 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||| |||||||||| |||||||| |
|
|
| T |
21809368 |
caggggcggatctctttggagatcctcaggtgccactgcac-ccccagttttgatataaat |
21809309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 351
Target Start/End: Complemental strand, 43080241 - 43080195
Alignment:
| Q |
305 |
ggcggatctctttggagacccctagatgccactgcaccccccagttt |
351 |
Q |
| |
|
||||||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
43080241 |
ggcggatctctttggagaccctcaggtgtcactgcaccccccagttt |
43080195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Complemental strand, 23086126 - 23086073
Alignment:
| Q |
308 |
ggatctctttggagacccctagatgccactgcaccccccagttttaatataaat |
361 |
Q |
| |
|
||||||| ||||||| || ||| |||||||||||||||||| |||| ||||||| |
|
|
| T |
23086126 |
ggatctccttggagatccataggtgccactgcaccccccagatttattataaat |
23086073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 301 - 362
Target Start/End: Original strand, 3418990 - 3419051
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3418990 |
caggggcggatctctttggagacccccagatgccactgcaccccccagtttttatataaatt |
3419051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 302 - 361
Target Start/End: Complemental strand, 29968777 - 29968718
Alignment:
| Q |
302 |
aggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaat |
361 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||||||||||||| ||| |||||||| |
|
|
| T |
29968777 |
aggggcggatctctttagagacccccaggtgccactgcaccccccaacttttatataaat |
29968718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 301 - 347
Target Start/End: Complemental strand, 19293003 - 19292957
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcacccccca |
347 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
19293003 |
caggggcggatctcttcagagacccccaggtgccactgcacccccca |
19292957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 2e-19; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 301 - 362
Target Start/End: Complemental strand, 4428955 - 4428894
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
4428955 |
caggggcggatctctttggagacccctaggtgccactgcaccccccagattttatataaatt |
4428894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 302 - 361
Target Start/End: Complemental strand, 14028370 - 14028311
Alignment:
| Q |
302 |
aggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaat |
361 |
Q |
| |
|
||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||| |
|
|
| T |
14028370 |
aggggcggatctctttggagacccccaggtgcaactgcaccccccagttttaatataaat |
14028311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 362
Target Start/End: Original strand, 17549150 - 17549211
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||||||||||||||||||||| || |||| |||||||||| |||||| ||||||||| |
|
|
| T |
17549150 |
caggggcggatctctttggagacccccaggtgcctctgcacccccaagtttttatataaatt |
17549211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 33061828 - 33061880
Alignment:
| Q |
300 |
ccaggggcggatctctttggagacccctagatgccactgcaccccccagtttt |
352 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33061828 |
ccagggacggatctctgtggagacccctaggtgccactgcaccccccagtttt |
33061880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 301 - 362
Target Start/End: Complemental strand, 31736969 - 31736909
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||||||| |||||||||| ||||||||| |
|
|
| T |
31736969 |
caggggcgaatctctttggagacccccaggtgccactgcac-ccccagtttttatataaatt |
31736909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 301 - 347
Target Start/End: Complemental strand, 37023038 - 37022992
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcacccccca |
347 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
37023038 |
caggggcggatctcttcagagacccccaggtgccactgcacccccca |
37022992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0097 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0097
Description:
Target: scaffold0097; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 301 - 361
Target Start/End: Complemental strand, 47657 - 47597
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaat |
361 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
47657 |
caggggcggatctctttggagacctctaggtgccactgcacccctcagttttgatataaat |
47597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 299 - 346
Target Start/End: Complemental strand, 35187691 - 35187644
Alignment:
| Q |
299 |
tccaggggcggatctctttggagacccctagatgccactgcacccccc |
346 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35187691 |
tccaggggcggatctctttagagacccccagatgccactgcacccccc |
35187644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 303 - 361
Target Start/End: Complemental strand, 8823662 - 8823604
Alignment:
| Q |
303 |
ggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaat |
361 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
8823662 |
ggggcggatctctttagagaccctcaggtgccactgcaccccccagttttgatataaat |
8823604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 300 - 347
Target Start/End: Original strand, 16204739 - 16204786
Alignment:
| Q |
300 |
ccaggggcggatctctttggagacccctagatgccactgcacccccca |
347 |
Q |
| |
|
|||||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
16204739 |
ccaggggcggatctctttagagacccccaggtgccactgcacccccca |
16204786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 304 - 362
Target Start/End: Original strand, 45071008 - 45071064
Alignment:
| Q |
304 |
gggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||| ||||| ||||||||| |
|
|
| T |
45071008 |
gggcggatctctttggagacccc-aggtgccactgcacccccc-gtttttatataaatt |
45071064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 304 - 352
Target Start/End: Complemental strand, 49084085 - 49084037
Alignment:
| Q |
304 |
gggcggatctctttggagacccctagatgccactgcaccccccagtttt |
352 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||| |||||||| |
|
|
| T |
49084085 |
gggcggatctctttggagacccccaagtgccactgcaccctccagtttt |
49084037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 301 - 361
Target Start/End: Complemental strand, 27993795 - 27993735
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaat |
361 |
Q |
| |
|
||||||||||||||||| |||||||| | || |||||||||||||| ||| |||||||| |
|
|
| T |
27993795 |
caggggcggatctctttagagaccccaaagtgtcactgcaccccccaacttttatataaat |
27993735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 306 - 361
Target Start/End: Complemental strand, 13284333 - 13284278
Alignment:
| Q |
306 |
gcggatctctttggagacccctagatgccactgcaccccccagttttaatataaat |
361 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||| |||||||| |||||||| |
|
|
| T |
13284333 |
gcggatctctttggagacccccaggtgccactgcacccaccagttttgatataaat |
13284278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 299 - 361
Target Start/End: Complemental strand, 32164998 - 32164937
Alignment:
| Q |
299 |
tccaggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaat |
361 |
Q |
| |
|
|||||||| ||||||||||||||||||| || |||||||| |||||| |||||| |||||||| |
|
|
| T |
32164998 |
tccaggggtggatctctttggagacccc-aggtgccactgtacccccgagttttgatataaat |
32164937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 43822972 - 43822924
Alignment:
| Q |
299 |
tccaggggcggatctctttggagacccctagatgccactgcacccccca |
347 |
Q |
| |
|
|||||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
43822972 |
tccaggggcggatctcttcagagacccccaggtgccactgcacccccca |
43822924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 203 - 256
Target Start/End: Complemental strand, 36577430 - 36577377
Alignment:
| Q |
203 |
taagaaacggtgaacaatttaatcgaagactctttgtttcaatattcattcata |
256 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||| |||| |||||| |||||| |
|
|
| T |
36577430 |
taagacacggtaaacaatttaatccaagactctttatttccatattccttcata |
36577377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 304 - 362
Target Start/End: Original strand, 4198205 - 4198262
Alignment:
| Q |
304 |
gggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||| ||| ||||||||| |
|
|
| T |
4198205 |
gggcggatctctttggagacccc-aggtgccactgcaccccccaggttttatataaatt |
4198262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 300 - 362
Target Start/End: Complemental strand, 36565848 - 36565786
Alignment:
| Q |
300 |
ccaggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
||||||||||||||||||| ||| ||| || |||||||||||||||||| ||| ||||||||| |
|
|
| T |
36565848 |
ccaggggcggatctctttgaagatccccaggtgccactgcaccccccagattttatataaatt |
36565786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 301 - 345
Target Start/End: Complemental strand, 25160709 - 25160665
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccc |
345 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
25160709 |
caggggcggatctctttagagacccctaggtgccactgcaccccc |
25160665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 301 - 347
Target Start/End: Original strand, 3712508 - 3712554
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcacccccca |
347 |
Q |
| |
|
|||||||||||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
3712508 |
caggggcggatctccttggagacccacaggtgccactgcacccccca |
3712554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 300 - 346
Target Start/End: Complemental strand, 16632369 - 16632323
Alignment:
| Q |
300 |
ccaggggcggatctctttggagacccctagatgccactgcacccccc |
346 |
Q |
| |
|
|||||||| ||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
16632369 |
ccaggggcagatctctttagagacccccaggtgccactgcacccccc |
16632323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 299 - 345
Target Start/End: Complemental strand, 43671496 - 43671450
Alignment:
| Q |
299 |
tccaggggcggatctctttggagacccctagatgccactgcaccccc |
345 |
Q |
| |
|
|||||| |||||||||||| |||||||| || ||||||||||||||| |
|
|
| T |
43671496 |
tccaggagcggatctctttagagacccccaggtgccactgcaccccc |
43671450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 301 - 347
Target Start/End: Complemental strand, 46671588 - 46671542
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcacccccca |
347 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
46671588 |
caggggcggatctcttcagagacccccaggtgccactgcacccccca |
46671542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0648 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0648
Description:
Target: scaffold0648; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 300 - 347
Target Start/End: Complemental strand, 4651 - 4604
Alignment:
| Q |
300 |
ccaggggcggatctctttggagacccctagatgccactgcacccccca |
347 |
Q |
| |
|
|||||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
4651 |
ccaggggcggatctctttagagacccccaggtgccactgcacccccca |
4604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0274
Description:
Target: scaffold0274; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 300 - 347
Target Start/End: Complemental strand, 4121 - 4074
Alignment:
| Q |
300 |
ccaggggcggatctctttggagacccctagatgccactgcacccccca |
347 |
Q |
| |
|
|||||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
4121 |
ccaggggcggatctctttagagacccccaggtgccactgcacccccca |
4074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 362
Target Start/End: Original strand, 7011315 - 7011375
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccccagttttaatataaatt |
362 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| || ||| |||||| ||||||||| |
|
|
| T |
7011315 |
caggggcggatctctttggagaccccaagttgccactaca-tccctagtttttatataaatt |
7011375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 301 - 345
Target Start/End: Original strand, 230291 - 230335
Alignment:
| Q |
301 |
caggggcggatctctttggagacccctagatgccactgcaccccc |
345 |
Q |
| |
|
||||||||||||||||| |||||||| || || |||||||||||| |
|
|
| T |
230291 |
caggggcggatctctttagagacccccaggtgtcactgcaccccc |
230335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University