View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14839_low_1 (Length: 271)
Name: NF14839_low_1
Description: NF14839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14839_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 13287685 - 13287923
Alignment:
| Q |
18 |
gatataaatcagctagtcaagtagccatgatattattatgtatatgaagattaatggatttgatttcattggtggaaattgctatattgtttttgttcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13287685 |
gatataaatcagctagtcaagtagccatggtattattatgtatatgaagattaatggatttgatttcattggtggaaattgctatattgtttttgttcta |
13287784 |
T |
|
| Q |
118 |
atccaaaattattgtcaaaatagacatttttcaaatggatagggtttgtgggtccatatgtatttatggtccagttgggtttgttgaggcccatttcctt |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13287785 |
atccaaaattattgtcaaactagacatttttcaaatggatagggtttgtgggtccatatgtatttatggtccagttgggtttgttgaggcccatttcctt |
13287884 |
T |
|
| Q |
218 |
tgccacctctataatctatctatatatctcctacttctt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13287885 |
tgccacctctataatctatctatatatctcctacttctt |
13287923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University