View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1483_high_6 (Length: 240)
Name: NF1483_high_6
Description: NF1483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1483_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 41702839 - 41702763
Alignment:
| Q |
1 |
atactctgcaaatgagtgaatgatgcgggagacaaattgagtcttaagcttcctgtatttggactgaagggagctcc |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41702839 |
atactctgcaaatgagtgaatgatgcgggagacaaattgagtcttaagcttcctgtatttggactgaagggagctcc |
41702763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 148 - 224
Target Start/End: Complemental strand, 41702684 - 41702608
Alignment:
| Q |
148 |
atatttgcatacacatgagatttatctaaactaaaagcacctgcacgttcttaccctttaaggaaatataattaatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41702684 |
atatttgcatacacatgagatttatctaaactaaaagcacccgcacgttcttaccctttaaggaaatataattaatt |
41702608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 9 - 77
Target Start/End: Original strand, 2425641 - 2425709
Alignment:
| Q |
9 |
caaatgagtgaatgatgcgggagacaaattgagtcttaagcttcctgtatttggactgaagggagctcc |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
2425641 |
caaatgagtgaatgatgcgggagacaaattgaatcttaagtttcctatacttggactgaagggagctcc |
2425709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University