View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1483_low_11 (Length: 231)
Name: NF1483_low_11
Description: NF1483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1483_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 215
Target Start/End: Original strand, 53251154 - 53251354
Alignment:
| Q |
15 |
aaatgaaggccaaatatttcgggcttggtaattgcacatgcaatagaggccggcaaacttgcaatataaaaggtttatcaagggaaaccttagaaacaac |
114 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53251154 |
aaatggaggccaaatatttcgggtttggtaattgcacatgcaatagaggccggcaaacttacaatataaaaggtttatcaagggaaaccttagaaacaac |
53251253 |
T |
 |
| Q |
115 |
gacacattttcactttgctttgcgatttgtttccttgtcaatacaaaaaagacttcaagtcactcaaattgcaagtaacatatattatgactgatcaacc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53251254 |
gacacattttcactttgctttgcgatttgtttccttgtcaatacaaaaaagacttcaagtcactcaaattgcaagtaacatatattatgactgatcaacc |
53251353 |
T |
 |
| Q |
215 |
c |
215 |
Q |
| |
|
| |
|
|
| T |
53251354 |
c |
53251354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University