View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484-Insertion-29 (Length: 206)
Name: NF1484-Insertion-29
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484-Insertion-29 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 125 - 206
Target Start/End: Original strand, 53214879 - 53214960
Alignment:
| Q |
125 |
gggggacatttatgttgttatggtttccacagaggccgttgtataagtagttgtggggttagtatgattgagttgagtgtgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53214879 |
gggggacatttatgttgttatggtttccacagaggccgttgtataagtagttgtggggttagtatgattgagttgagtgtgt |
53214960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University