View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484-Insertion-31 (Length: 193)
Name: NF1484-Insertion-31
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484-Insertion-31 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 7 - 193
Target Start/End: Complemental strand, 35578028 - 35577842
Alignment:
| Q |
7 |
atttagtgcaaagaataacatcaggtttataaccacgattaaccatgtgttgaagaaagtataaagattcatcgtacttagctgatttgcatgatctgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35578028 |
atttagtgcaaagaataacatcaggtttataaccacgattaaccatgtgttgaagaaagtataaagattcatcgtacttagctgatttgcatgatctgtt |
35577929 |
T |
|
| Q |
107 |
taaggttttcatgaaattggtgtctcggaaatcgtagtctttgtcgtgttttgttggttttgtttcattgacgcggaattgttgttg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35577928 |
taaggttttcatgaaattggtgtctcggaaatcgtagtcttggtcgtgttttgttggttttgtttcattgacgcggaattgttgttg |
35577842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4145 times since January 2019
Visitors: 1238