View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484-Insertion-34 (Length: 153)
Name: NF1484-Insertion-34
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484-Insertion-34 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 4e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 4e-55
Query Start/End: Original strand, 8 - 153
Target Start/End: Complemental strand, 17398547 - 17398394
Alignment:
| Q |
8 |
cctttgattcacaagggaaaagagccttagtaatacgcagttcggttcagatggcaagtaaagtttgaccaaggattgttccagcaaggattc------- |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17398547 |
cctttgattcacaagggaaaagagccttagtaatacgcagttcggttcagatggcaagtaaagtttgaccaaggattattccagcaaggattcgaactca |
17398448 |
T |
|
| Q |
101 |
-aaactattaatcgatttgtctttaattgaaggtgatcaaccacttggttatgc |
153 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17398447 |
agaactcttagtcgatttgtctttaattgaaggtgatcaaccacttggttatgc |
17398394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 36 - 90
Target Start/End: Complemental strand, 17404923 - 17404869
Alignment:
| Q |
36 |
agtaatacgcagttcggttcagatggcaagtaaagtttgaccaaggattgttcca |
90 |
Q |
| |
|
|||||| || ||||| ||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17404923 |
agtaatccgtagttcagtttagatggcaagtaaagtttgaccaagaattgttcca |
17404869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 63 - 105
Target Start/End: Original strand, 39502550 - 39502592
Alignment:
| Q |
63 |
aagtaaagtttgaccaaggattgttccagcaaggattcaaact |
105 |
Q |
| |
|
||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
39502550 |
aagtaaagtttgaccaatgattattccagctaggattcaaact |
39502592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University