View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484-Insertion-39 (Length: 95)
Name: NF1484-Insertion-39
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484-Insertion-39 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 4e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 8 - 95
Target Start/End: Original strand, 27935611 - 27935698
Alignment:
| Q |
8 |
tatgtctccccttcagttctttctatttgtttcttccattttatcgtttcttaaccatccctaccccgtggattttctagttaattaa |
95 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27935611 |
tatgtcttccctttagttctttctatttgtttcttccattttatcgtttcttaaccatccctaccccgtggattttctagttaattaa |
27935698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University