View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484-Insertion-44 (Length: 73)
Name: NF1484-Insertion-44
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484-Insertion-44 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 1e-25; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 15 - 73
Target Start/End: Original strand, 24616397 - 24616455
Alignment:
| Q |
15 |
cataattaaattagcaatctctttgtttatttattctgacattcacttcattaatattt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24616397 |
cataattaaattagcaatctctttgtttatttattctgacattcacttcattaatattt |
24616455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 24107706 - 24107655
Alignment:
| Q |
15 |
cataattaaattagcaatctctttgtttatttattctgacattcacttcatt |
66 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
24107706 |
catacttaaattaacaatctctttgtttatttgttctgacatttacttcatt |
24107655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.00000000008
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 24114407 - 24114366
Alignment:
| Q |
16 |
ataattaaattagcaatctctttgtttatttattctgacatt |
57 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
24114407 |
ataattaaattaacaatctctttgtttatttattcttacatt |
24114366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University