View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1484-Insertion-45 (Length: 70)

Name: NF1484-Insertion-45
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1484-Insertion-45
NF1484-Insertion-45
[»] chr8 (1 HSPs)
chr8 (7-70)||(29157846-29157909)
[»] chr3 (2 HSPs)
chr3 (7-70)||(11982146-11982209)
chr3 (7-70)||(18770402-18770465)


Alignment Details
Target: chr8 (Bit Score: 60; Significance: 2e-26; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 7 - 70
Target Start/End: Original strand, 29157846 - 29157909
Alignment:
Q  7 atgtctagtcatcttgcttgtttagccattggtggattatttgatttagtctatgcagtggtag 70  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  29157846 atgtctagtcatcttgcttgtttagccattggtggattatttgatttagtctatgtagtggtag 29157909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 60; Significance: 2e-26; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 7 - 70
Target Start/End: Complemental strand, 11982209 - 11982146
Alignment:
Q  7 atgtctagtcatcttgcttgtttagccattggtggattatttgatttagtctatgcagtggtag 70  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  11982209 atgtctagtcatcttgcttgtttagccattggtggattatttgatttagtttatgcagtggtag 11982146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 7 - 70
Target Start/End: Original strand, 18770402 - 18770465
Alignment:
Q  7 atgtctagtcatcttgcttgtttagccattggtggattatttgatttagtctatgcagtggtag 70  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  18770402 atgtctagtcatcttgcttgtttagccattggtggattatttgatttagtttatgcagtggtag 18770465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University