View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484-Insertion-8 (Length: 388)
Name: NF1484-Insertion-8
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484-Insertion-8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 8 - 388
Target Start/End: Original strand, 17470490 - 17470870
Alignment:
| Q |
8 |
taaactacatgtttgctccatggatttcttggctacttttgttacaatcatcaccaattgtaccacctgcagcacttcattacaaaatcctctggttatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17470490 |
taaactacatgtttgctccatggatttcttggttacttttgttacaatcatcgccaattgtaccacctgcagcacttcattacaaaatcctctggttatt |
17470589 |
T |
|
| Q |
108 |
gtttgttgttcctgtggttattcttgatgtgaaaatctatggtcagtggtttactaaagggaagatgtttttgtcgatggttgcgaatccgacgagtcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17470590 |
gtttgttgttcctgtggttattcttgatgtgaaaatttatggtcagtggtttactaaagggaagatgtttttgtcgatggttgcgaatccgacgagtcaa |
17470689 |
T |
|
| Q |
208 |
atgtctgttattggtaacttggttgctgcactagctgctgcacaaatgggttggaaagagagtgcaatatgcnnnnnnnctcttggtattgcacattatt |
307 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17470690 |
atgtctgtcattggtaacttggttgctgcactagctgctgcacaaatgggttggaaagagagtgcaatatgctttttttctcttggtattgcacattatt |
17470789 |
T |
|
| Q |
308 |
tggtactttttgttacattatatcaaagattgccggggaataataagattccggcgatgttgcgaccggtgttcttcttgt |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17470790 |
tggtactttttgttacattatatcaaagattgccggggaataataagattccggcgatgttgcgaccggtgttcttcttgt |
17470870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Original strand, 52780081 - 52780138
Alignment:
| Q |
115 |
gttcctgtggttattcttgatgtgaaaatctatggtcagtggtttactaaagggaaga |
172 |
Q |
| |
|
||||| |||||| |||| ||||| ||||| || || |||||||||||||||||||||| |
|
|
| T |
52780081 |
gttccggtggttgttctcgatgttaaaatttacggccagtggtttactaaagggaaga |
52780138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University