View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14840_high_5 (Length: 237)
Name: NF14840_high_5
Description: NF14840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14840_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 25583657 - 25583878
Alignment:
| Q |
1 |
tttagggcactttggatcatcttcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctgttagagtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583657 |
tttagggcactttggatcatcttcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctgttagagtat |
25583756 |
T |
|
| Q |
101 |
ctctgttggttgtttccatcttcttggtttagctcagtggacacacatgaacttggtggggatgtaggtgacactgttgctgatcttgttggtgatgact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583757 |
ctctgttggttgtttccatcttcttggtttagctcagtggacacacatgaacttggtggggatgtaggtgacactgttgctgatcttgttggtgatgact |
25583856 |
T |
|
| Q |
201 |
caactcttctgtggtcaaccct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
25583857 |
caactcttctgtggtcaaccct |
25583878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 91
Target Start/End: Complemental strand, 42894155 - 42894075
Alignment:
| Q |
11 |
tttggatcatcttcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctg |
91 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||| ||||||||||||||||| || || | |||||| || ||||| |||||| |
|
|
| T |
42894155 |
tttggatcattctcagagagcatcacatacatgagacaacgaggacaacctactaacagcatggaggttgcttcagggctg |
42894075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University