View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14840_low_3 (Length: 266)
Name: NF14840_low_3
Description: NF14840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14840_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 259
Target Start/End: Original strand, 33728674 - 33728916
Alignment:
| Q |
17 |
atatacagttttgcattcttcagttttcaaatttttcatcaatttgttacggttgcaggttgaggagttgaatgcaatggcaaaagagaatgnnnnnnnt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33728674 |
atatacagttttgcattcttcagttttcaaatttttcatcaatttgttacggttgcaggttgaggagttgaatgcaatggcaaaagagaatgaaaaaaat |
33728773 |
T |
|
| Q |
117 |
ccggttgtaatgccaaacagtaaattcaatggatctacttcaacccctctagtgtgtgagcacaaagaaatggaagtgccccattttgcacttggactat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33728774 |
ccggttgtaatgccaaacagtaaattcaatggatctacttcaacccctctagtgtgtgagcacaaagaaatggaagtgccccattttgcacttggactat |
33728873 |
T |
|
| Q |
217 |
gtgaaacttgttacaaggatgttagtagtttctttcttgccta |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33728874 |
gtgaaacttgttacaaggatgttagtagtttctttcttgccta |
33728916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 104
Target Start/End: Complemental strand, 9498234 - 9498180
Alignment:
| Q |
50 |
tttcatcaatttgttacggttgcaggttgaggagttgaatgcaatggcaaaagag |
104 |
Q |
| |
|
|||||||||| | ||| |||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
9498234 |
tttcatcaatatcttatggttacagattgatgagttgaatgcaatggcaaaagag |
9498180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University