View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14840_low_4 (Length: 260)

Name: NF14840_low_4
Description: NF14840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14840_low_4
NF14840_low_4
[»] chr4 (1 HSPs)
chr4 (19-167)||(49924227-49924375)


Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 167
Target Start/End: Complemental strand, 49924375 - 49924227
Alignment:
19 ggagatagcttttcacttactcgttgattggaggaatatagccaatactattcattcacgtccctgttaccattagcgctgcaaccgcgagtggtgatct 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49924375 ggagatagcttttcacttactcgttgattggaggaatatagccaatactattcattcacgtccctgttaccattagcgctgcaaccgcgagtggtgatct 49924276  T
119 ggacagtggccgctgggaaaaaatcgaaatgtgcatccgtgatgaggat 167  Q
    ||||| |||||| ||| |||||||| |||||||||||||||||||||||    
49924275 ggacaatggccgttggaaaaaaatcaaaatgtgcatccgtgatgaggat 49924227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University