View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14840_low_5 (Length: 237)

Name: NF14840_low_5
Description: NF14840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14840_low_5
NF14840_low_5
[»] chr1 (1 HSPs)
chr1 (1-222)||(25583657-25583878)
[»] chr7 (1 HSPs)
chr7 (11-91)||(42894075-42894155)


Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 25583657 - 25583878
Alignment:
1 tttagggcactttggatcatcttcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctgttagagtat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25583657 tttagggcactttggatcatcttcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctgttagagtat 25583756  T
101 ctctgttggttgtttccatcttcttggtttagctcagtggacacacatgaacttggtggggatgtaggtgacactgttgctgatcttgttggtgatgact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25583757 ctctgttggttgtttccatcttcttggtttagctcagtggacacacatgaacttggtggggatgtaggtgacactgttgctgatcttgttggtgatgact 25583856  T
201 caactcttctgtggtcaaccct 222  Q
    ||||||||||||||||||||||    
25583857 caactcttctgtggtcaaccct 25583878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 91
Target Start/End: Complemental strand, 42894155 - 42894075
Alignment:
11 tttggatcatcttcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctg 91  Q
    ||||||||||  ||||| ||||| |||||||| ||||||||||||||||| || || | |||||| || ||||| ||||||    
42894155 tttggatcattctcagagagcatcacatacatgagacaacgaggacaacctactaacagcatggaggttgcttcagggctg 42894075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University