View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14841_high_17 (Length: 338)
Name: NF14841_high_17
Description: NF14841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14841_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 16 - 264
Target Start/End: Complemental strand, 39724432 - 39724189
Alignment:
| Q |
16 |
tcaacgagttggaaatcgatcgagagggttatgtagttgaaatgatgtcannnnnnnnnnnnnnnattgtgaaaaatgtaatattgaaggaaacaaataa |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39724432 |
tcaacaagttggaaatcgatcgagagggttatgtagttgaaatgatgtcatttttttttt-----attgtgaaaaatgtaatattgaaggaaacaaataa |
39724338 |
T |
 |
| Q |
116 |
ttaaggaaaaaatgtctgatttgtttgtccttgtttttatacctgtagttgttcattttattatgttgtcatatatacctctaatgaattatttctgtgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39724337 |
ttaaggaaaaaatgtctgatttgtttgtccttgtttttatacctgtagttgttcattttattatgttgtcatatatacctctaatgaattatttatgtgc |
39724238 |
T |
 |
| Q |
216 |
taacgactagtagtctagtacattggtaaccagctattaatgtactatt |
264 |
Q |
| |
|
| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39724237 |
ttactactagtagtctagtacattggtaaccagctattaatgtactatt |
39724189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University