View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14841_high_37 (Length: 232)

Name: NF14841_high_37
Description: NF14841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14841_high_37
NF14841_high_37
[»] chr3 (2 HSPs)
chr3 (162-220)||(43760595-43760653)
chr3 (1-46)||(43760448-43760493)


Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 162 - 220
Target Start/End: Original strand, 43760595 - 43760653
Alignment:
162 gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattggttcttttc 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43760595 gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattggttcttttc 43760653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 43760448 - 43760493
Alignment:
1 cttgaattttttgtgcttttgcttcacattcacaagacgggtaccc 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
43760448 cttgaattttttgtgcttttgcttcacattcacaagacgggtaccc 43760493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University