View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14841_high_37 (Length: 232)
Name: NF14841_high_37
Description: NF14841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14841_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 162 - 220
Target Start/End: Original strand, 43760595 - 43760653
Alignment:
| Q |
162 |
gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattggttcttttc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760595 |
gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattggttcttttc |
43760653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 43760448 - 43760493
Alignment:
| Q |
1 |
cttgaattttttgtgcttttgcttcacattcacaagacgggtaccc |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760448 |
cttgaattttttgtgcttttgcttcacattcacaagacgggtaccc |
43760493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University