View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14841_high_42 (Length: 212)
Name: NF14841_high_42
Description: NF14841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14841_high_42 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 3463258 - 3463040
Alignment:
| Q |
1 |
cttaacttctgatacatttatgcgatcgagagttacgatatgataaatatgagagacttttgaacaacttaaggttggatagagcaattctctaatgatt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3463258 |
cttaactcctgatacatttatgcgatcgagagttaccatatgataaatatgagagacttttgaacaacttaaggttggatagagcaattctctaatgatt |
3463159 |
T |
 |
| Q |
101 |
ttttcattttaaattgtaattttatgatcaaaatcaccatgacacattttgactccccaaaattaatcctcaattcaaacataaata-gaaa------ac |
193 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
3463158 |
ttttcatttcaaattgtaattttatgatcaaaatcaccgtgacacattttgactccccaaaattaatcctcaattcaaacataaatatgaaaattgagac |
3463059 |
T |
 |
| Q |
194 |
acatacgaccttatatttt |
212 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3463058 |
acatacgaccttatatttt |
3463040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University