View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14841_high_44 (Length: 206)
Name: NF14841_high_44
Description: NF14841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14841_high_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 4 - 199
Target Start/End: Original strand, 50602818 - 50603031
Alignment:
| Q |
4 |
ctagacttgaagcggggcaattttgttggggtccagccaacagtagtgcaca-----------------aatgtgaa-tgttgaattttcttatcctaca |
85 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
50602818 |
ctagacttgaggcggggcaattttgttggggtccagccaacagtagtgcacagtggtgcactgtgcacaaatgtgaaatgttgaattttcttatcctaca |
50602917 |
T |
 |
| Q |
86 |
tgcacatatgatcatagcatgcggtgcttaatttctacttgtgtcaggataaatggaaaatgggtgcaacaatgtttgaaagtgtgaaccaagcatttaa |
185 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50602918 |
tgcacatatgatcatagcatgtggtgcttaatttctacttgtgtcaggataaatggaaaatgggtgcaacaatgtttgaaagtgtgaaccaagcatttaa |
50603017 |
T |
 |
| Q |
186 |
tgcttgcggttcat |
199 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
50603018 |
tgcttacggttcat |
50603031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University