View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14841_low_15 (Length: 342)
Name: NF14841_low_15
Description: NF14841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14841_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 11 - 329
Target Start/End: Complemental strand, 42799454 - 42799136
Alignment:
| Q |
11 |
acatcatcacacaacccgccgtgattcatatgttggcagaatgtgctggacttcaatggttcgaaagttggggaaccaaggaactatctgatgttggtct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799454 |
acatcatcacacaacccgccgtgattcatatgttggcagaatgtgccggacttcaatggttcgaaagttggggaaccaaggaactatctgatgttggtct |
42799355 |
T |
|
| Q |
111 |
tccccttgtgacaccaaaacagatcatcaaggtgtgtactatatcatataagctctcattgcattgaaccttgtcaagtatgaattctgcataactctag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799354 |
tccccttgtgacaccaaaacagatcatcaaggtgtgtactatatcatataagctctcattgcattgaaccttgtcaagtatgaattctgcataactctag |
42799255 |
T |
|
| Q |
211 |
tgcatacagagtaaaatgctatcttgcatttcttaaatgtgtgtgcatatatggaaaatgcttcaaaatagttatttcatttcccctttcaagtaaagca |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42799254 |
tgcatacagagtaaaatgctatcttgcatttcttaaatgtgtgtgcatatatggaaaatgcttcaaaatagttatttcatttcccctttcaagtaaagta |
42799155 |
T |
|
| Q |
311 |
agcttgtcgatcttgatga |
329 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
42799154 |
aacttgtcgatcttgatga |
42799136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University